Is this you? As a journalist, you can create a free Muck Rack account to customize your profile, list your contact preferences, and upload a portfolio of your best work.
Claim your profile
Articles by Dietmar Rudolf
Alzheimer's disease neuropathology and its estimation with fluid and imaging biomarkers - Molecular Neurodegeneration
References Masters CL, Simms G, Weinman NA, Multhaup G, McDonald BL, Beyreuther K. Amyloid plaque core protein in Alzheimer disease and Down syndrome. Proc Natl Acad Sci U S A. 1985;82:4245–9. CAS PubMed PubMed Central Google Scholar Grundke-Iqbal I, Iqbal K, Quinlan M, Tung YC, Zaidi MS, Wisniewski M. Microtubule-associated protein tau. A component of Alzheimer paired helical filaments. J Biol Chem. 1986;261:6084–9.
Production of Distinct Fibrillar, Oligomeric, and Other Aggregation States from Network Models of Multibody Interaction
1. Introduction Click to copy section linkSection link copied! Protein aggregation is a fundamental biophysical process, implicated in both functional and disease processes. Among the most striking─and important─classes of protein aggregates are fibrils. Fibrils are highly structured peptide aggregates consisting of repeated patterns of interactions between protein monomers and oligomers. Fibrils are implicated in a wide variety of chronic diseases, (1−3) while also having some functional roles.
A toxic gain-of-function mechanism in C9orf72 ALS impairs the autophagy-lysosome pathway in neurons - Acta Neuropathologica Communications
The two human ALS patient-derived iPSC lines carrying a C9orf72 HRE and their respective isogenic controls were previously described in [41], while the C9orf72 KO line was was generated using SYNTHEGO multi-guide sgRNA to delete a 130-base pair (bp) fragment in exon 2 of the C9orf72 gene (sgRNA-1: TTGGGCTCCAAAGACAGAAC; sgRNA-2: TAGCAGCTACTTTTGCTTAC; sgRNA-3: CCGCCATCTCCAGCTGTTGC). Control iPSCs were detached by incubation with Accutase for 3–5 min at 37°C.
Senescence-related impairment of autophagy induces toxic intraneuronal amyloid-β accumulation in a mouse model of amyloid pathology - Acta Neuropathologica Communications
Animals Terc knockout mice [8] (Strain #004132, The Jackson Laboratory), carrying a germline deletion for the telomerase RNA subunit Terc, and 5xFAD transgenic mice [87] (Strain #034840-JAX, The Jackson Laboratory), expressing human APP and PSEN1 transgenes with a total of five familial AD (FAD) mutations (Swedish [K670N/M671L], Florida [I716V], and London [V717I] mutations in APP, and M146L and L286V mutations in PSEN1), were bred. All mice were maintained on a C57BL/6 genetic background.
Increased pyroptosis activation in white matter microglia is associated with neuronal loss in ALS motor cortex - Acta Neuropathologica
Abstract Amyotrophic lateral sclerosis (ALS) is characterized by the degeneration of motor neurons in the motor cortex, brainstem, and spinal cord. Although ALS is considered a motor neuron disorder, neuroinflammation also plays an important role. Recent evidence in ALS disease models indicates activation of the inflammasome and subsequent initiation of pyroptosis, an inflammatory type of cell death.
Frontotemporal lobar degeneration case with an N-terminal TUBA4A mutation exhibits reduced TUBA4A levels in the brain and TDP-43 pathology
Please use this identifier to cite or link to this item: http://dx.doi.org/10.25673/85411 Title: Frontotemporal lobar degeneration case with an N-terminal TUBA4A mutation exhibits reduced TUBA4A levels in the brain and TDP-43 pathology Type: Article Language: English Abstract: Recently, disease-associated variants of the TUBA4A gene were identified in patients with amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD).
Mapping the sequence specificity of heterotypic amyloid interactions enables the identification of aggregation modifiers - Nature Communications
Abstract Heterotypic amyloid interactions between related protein sequences have been observed in functional and disease amyloids. While sequence homology seems to favour heterotypic amyloid interactions, we have no systematic understanding of the structural rules determining such interactions nor whether they inhibit or facilitate amyloid assembly.
The probabilistic model of Alzheimer disease: the amyloid hypothesis revised - Nature Reviews Neuroscience
1. Prince, M. et al. World Alzheimer Report 2015. The Global Impact of Dementia - An Analysis of Prevalence, Incidence, Cost and Trends. https://www.alzint.org/u/WorldAlzheimerReport2015.pdf (2015). 2. Ballard, C. et al. Alzheimer’s disease. Lancet 377, 1019–1031 (2011). PubMed Google Scholar 3. Jack, C. R. et al. NIA-AA research framework: toward a biological definition of Alzheimer’s disease. Alzheimers Dement. 14, 535–562 (2018). PubMed PubMed Central Google Scholar 4. Hardy, J. A. & Higgins, G. A.
Show More
loading
Actions
Is this you?
As a journalist, you can create a free Muck Rack account to customize your profile, list your contact preferences, and upload a portfolio of your best work.Get in touch with Dietmar
Contact Dietmar, search articles and posts on X, monitor coverage, and track replies from one place.
Learn more about Muck Rack