Kohtarou Konno

Keywords smooth endoplasmic reticulum sER dendritic spine cytoskeleton septin L-LTP memory consolidation Research topic(s) CP: Neuroscience CP: Cell biology Introduction Long-term potentiation (LTP) of excitatory synaptic transmission is pharmacologically divided into protein synthesis-independent and -dependent components, corresponding, respectively, to the early/transient and late/persistent phases (E-/L-LTP).1,2,3 E- and L-LTP are considered to be the synaptic substrates of short-term...

Abstract The gold-standard fixative for immunohistochemistry is 4% formaldehyde; however, it limits antibody access to target molecules that are buried within specialized neuronal components, such as ionotropic receptors at the postsynapse and voltage-gated ion channels at the axon initial segment, often requiring additional antigen-exposing techniques to detect their authentic signals. To solve this problem, we used glyoxal, a two-carbon atom di-aldehyde.

Method details Generation of transgenic mouse models The Nrxn3 AS5HA knock-in allele was obtained by CRISPR/Cas9-mediated gene editing in electroporated mouse embryos. The target sequence atgtccatgtaagggcggca(cgg) (PAM sequence in brackets) was selected with CRISPOR software ( ).