Skip To Main Content
Naomi Taylor on Muck Rack

Naomi Taylor

Verified
London
As seen in: BBC StoryWorks, Yahoo Life, Nature, Yahoo News, Yahoo Finance, Liverpool Echo, Yahoo, Lifehack!, The Drum, Cell Press, Campaign (UK) and
Just here for a good time, cheese and Succession memes. Managing Editor @BBCStoryWorks, cut teeth @CNNCreate, @Wix & @TheDrum - all views are my own.
Is this you? As a journalist, you can create a free Muck Rack account to customize your profile, list your contact preferences, and upload a portfolio of your best work. Claim your profile

Get in touch with Naomi

Contact Naomi, search articles and posts on X, monitor coverage, and track replies from one place.

Learn more about Muck Rack

Actions

Share this page

Is this you?

As a journalist, you can create a free Muck Rack account to customize your profile, list your contact preferences, and upload a portfolio of your best work.
Claim your profile

Articles

RPS19 and RPL5 haploinsufficient models reveal divergent ribosomal subunit controls of fetal hematopoiesis

|
By Yuefeng Tang, Rashid Mehmood, Alexis Bertrand, Julien Papoin, Jianing Xu, Vincent P. Schulz, James Palis, Laurie A. Steiner, Betsy J. Barnes, Yong-Rui Zou, Philippe Marambaud, Robert A. J. Signer, Irene Roberts, Leonard I. Zon, Senthil Velan Bhoopalan, Mitchell Weiss, Jeffrey Lipton, PATRICK GALLAGHER, Narla Mohandas, Naomi Taylor Verified, Sébastien Durand, John Crispino, Lionel Blanc, Mushran Khan, Riaz Rao, Deena Iskander
| Nature Verified
Abstract Diamond Blackfan anemia syndrome (DBAS) is a congenital ribosomopathy caused by haploinsufficiency of ribosomal proteins (RPs), but how RP stoichiometry and activity regulates erythroid development remains enigmatic. Using in vivo models, we uncover divergent functions for the small and large ribosomal subunit proteins RPS19 and RPL5 in fetal hematopoiesis.
Open in Who Shared Issue with article?

U2AF regulates the translation and localization of nuclear-encoded mitochondrial mRNAs

|
By Gloria Garcia, Murali Palangat, Josquin Moraly, Benjamin Donovan, Bixuan Wang, David A. Sturgill, Jiji Chen, Guofeng Zhang, Ronald Holewinski, Gustavo Rivero, David M. Swoboda, Naomi Taylor Verified, Kathy McGraw, Daniel Larson, Ira Phadke, Brittney Short, Naomi Taylor, Ira Phadke, Daniel R. Lar
| Cell Press Verified
U2AF1-3XFLAG cell line We used CRISPR/Cas9 to tag endogenous U2AF1 with a 3XFLAG epitope in Human Bronchial Epithelial Cells (HBECs) cultured in Keratinocyte SFM media (Gibco, 17005042). The U2AF1-3XFLAG donor plasmid, derived from the base plasmid pUC19, has approximately 800 bp flanking homology arms. Amplification of these homology arms used the following primers: Forward: TGTTGGGCTGCAGGTTGGACAAGC and Reverse: CTGGGTGACTCCCACCTAGAGC.
Open in Who Shared Issue with article?

ASU honors legacy of Alabama quilters, from economic impact to cultural heritage Original

|
By Naomi Taylor Verified
| Montgomery Advertiser Verified
ASU honors legacy of Alabama quilters, from economic impact to cultural heritage This story is part of a partnership between the Montgomery Advertiser and the Living Democracy program at Auburn University. Now in its 13th year, the program disperses students across rural Alabama to spend 10 weeks learning more about the inner workings of the community and writing about what they observe.
Open in Who Shared View Duplicates (5) Issue with article?
See all 24 licensed articles (292 Total)