Is this you? As a journalist, you can create a free Muck Rack account to customize your profile, list your contact preferences, and upload a portfolio of your best work.
Claim your profile
Get in touch with Ira
Contact Ira, search articles and posts on X, monitor coverage, and track replies from one place.
As a journalist, you can create a free Muck Rack account to customize your profile, list your contact preferences, and upload a portfolio of your best work.
ArticleOnline now102884Open access Affiliations & Notes 1Pediatric Oncology Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA 2Department of Radiation Oncology, University of Pittsburgh, Pittsburgh, PA, USA 3Molecular Imaging Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD, USA 4Hillman Cancer Center, University of Pittsburgh School of Medicine, Pittsburgh, PA, USA...
U2AF1-3XFLAG cell line We used CRISPR/Cas9 to tag endogenous U2AF1 with a 3XFLAG epitope in Human Bronchial Epithelial Cells (HBECs) cultured in Keratinocyte SFM media (Gibco, 17005042). The U2AF1-3XFLAG donor plasmid, derived from the base plasmid pUC19, has approximately 800 bp flanking homology arms. Amplification of these homology arms used the following primers: Forward: TGTTGGGCTGCAGGTTGGACAAGC and Reverse: CTGGGTGACTCCCACCTAGAGC.
As a journalist, you can create a free Muck Rack account to customize your profile, list your contact preferences, and upload a portfolio of your best work.
