Is this you? As a journalist, you can create a free Muck Rack account to customize your profile, list your contact preferences, and upload a portfolio of your best work.
Claim your profile
Articles by Chen Zhu
Multimodal hydrogel modulation of extracellular vesicle cargo to arrest post-traumatic osteoarthritis in murine models
Abstract Effective prophylactic interventions for exercise-induced joint damage and preclinical osteoarthritis remain elusive, as abnormal mechanical loading drives pathology through a dual pyroptotic loop between chondrocytes and macrophages. We present PMUC, a mechano-responsive lubricating hydrogel engineered for graded joint protection and repair. Mimicking native lubrication, intra-articular PMUC forms a persistent hydration layer that dissipates mechanical stress.
Predicting dengue incidence in China using SARIMA and hybrid neural network models: insights for public health planning
Abstract Dengue fever remains a persistent public health challenge in tropical and subtropical regions of China, disproportionately affecting economically disadvantaged and resource-limited areas. Outbreaks of dengue can strain healthcare systems and hinder socio-economic development. Developing timely and accurate forecasting models for dengue incidence is essential to strengthen early warning systems and inform the strategic allocation of public health resources.
Femtosecond-Laser-Inscribed Cladding Fiber Bragg Gratings: Architectures, Design Trade-Offs and Future Sensing Opportunities
1 Introduction Among the various optical-fiber sensing technologies developed over the past several decades, fiber Bragg gratings (FBGs) have emerged as one of the most widely adopted platforms because of their compactness, multiplexing capability, and robustness in demanding operating environments [1-4]. The first demonstration of an in-fiber Bragg grating was reported by Ken Hill et al. in 1978 [5], marking the beginning of FBG technology.
Manipulating Peierls-Nabarro stress to realize extraordinary thermoelectric performance in n-type PbTe
Abstract PbTe is recognized as one of the best intermediate-temperature thermoelectric materials; however, its commercial applications are largely restricted by the comparatively lower performance of its n-type counterpart. Here we show that Peierls-Nabarro stress is manipulated through solute-induced lattice softening, which generates high density helical dislocations, dislocation loops, and subgrain boundaries to block heat transport phonons.
Larger habitat islands maintain more persistent mutualistic assemblages
Abstract Habitat loss and fragmentation threaten biodiversity by reducing species richness and disrupting ecological interactions. But it is poorly understood how reduced habitat area and increased isolation impact community persistence, as measured by its capacity to maintain multispecies coexistence.
Redirecting wet–interfacial redox pathways for efficient inverted perovskite solar cells
|
Editor’s summary Abstract Supplementary Materials References and Notes Information & Authors Metrics & Citations Check Access References Figures Tables Media Share Editor’s summary Conjugated hydrazide additives limit the adverse effect of protons from hole-selective contacts with perovskite inks. Liang et al. found that the acidity of carbazole-based phosphonic self-assembled monolayers triggered detrimental iodide redox reactions mediated by the dimethyl sulfoxide used in perovskite precursors.
By Yuri Takeda-Kimura, Zhiyong Li, Mingjun Zhang, Zheng Liang, Boyuan Liu, Yuelong Li, Yalan Zhang, Yi Yang, Linchuan Ma, Bao Ngan Tu, Huifen Xu, Yuqi Bao, Minghui Fan, Peide Zhu, Xianfu Zhang, Congqi Li, Xinyuan Zhang, Yuheng Li, Guodong Chen, Cheng Liu, Chen Zhu, Chuying Ouyang, Shengbin Cheng, Hua-Chao Liu
|
Science Magazine
Verified
Associations between prediabetes, type 2 diabetes, and incident arrhythmias: a population-based cohort study and Mendelian randomization analysis
Keywords Prediabetes Diagnostic criteria Arrhythmias Mendelian randomization Get full text access Log in, subscribe or purchase for full access. References 1. Rooney, M.R. ... Global prevalence of prediabetes Diabetes Care. 2023; 46:1388-1394 2. Cai, X. ... Association between prediabetes and risk of all cause mortality and cardiovascular disease: updated meta-analysis BMJ. 2020; 370, m2297 3. Cui, K. ...
MXene-Based Optical Fiber Sensors for Chemical and Biosensing: Review and Perspectives Click to copy article link Article link copied!
Special Issue Published as part of Analytical Chemistry special issue “Fundamental and Applied Reviews in Analytical Chemistry 2027”. Introduction Click to copy section linkSection link copied! Sensors form the cornerstone of modern technological systems, underpinning applications ranging from environmental monitoring and industrial process control to biomedical diagnostics and human–machine interface devices.
Diverse radical transformations of allenic C(sp)–C(sp 2 ) and C(sp 3 )–C(sp 2 ) bonds enabled by silyl substitution
Abstract While the oxidative cleavage of olefins is well established, the radical-mediated, chemo- and regioselective cleavages of allene C(sp)–C(sp2) and C(sp3)–C(sp2) bonds remain unresolved challenges in synthetic chemistry. These challenges primarily stem from the high reactivity of the unique twisted orthogonal π-systems and the regioselectivity issues associated with adjacent C = C double bonds.
Consumer Ethnocentrism, Risk Perception, and Chinese Consumers' Choices for Aquatic Food After Wastewater Discharge
Data Availability Statement The data will be made available upon request. Supporting Information Filename Description agr70127-sup-0001-supplementary.docx325.4 KB Supporting File. References , and . 2011. “ Discrete Choice Theory and Modeling.” In The Oxford Handbook of the Economics of Food Consumption and Policy, edited by J. L. Lusk, J. Roosen, and J. F. Shogren. Oxford University Press. https://doi.org/10.1093/oxfordhb/9780199569441.013.0006. , , , and . 2006.
Organocatalytic Cascade Synthesis of 2,4,6-Trisubstituted Pyridines via Nucleophilic Activation of α -Chlorothioester
, , , , , Organocatalytic Cascade Synthesis of 2,4,6-Trisubstituted Pyridines via Nucleophilic Activation of α-Chlorothioester, European Journal of Organic Chemistry2026, 0, e70629. https://doi.org/10.1002/ejoc.70629 Conflicts of Interest The authors declare no conflicts of interest. Data Availability Statement The data that supports the findings of this study are available in the supporting information of this article.
A temporal map of B cell diversification mechanisms in mice
|
Abstract Naive B cells diversify via clonal expansion, immunoglobulin isotype switching, phenotypic variation and somatic hypermutation (SHM). Diversity in antigenic targets, functional classes and the production kinetics of antibodies affects immunity to malaria. Here we show that individual clones diversify over time during Plasmodium infection.
By Oliver Skinner, Saba Asad, Marcela L. Moreira, Hyun Lee, Zheng Ruan, Jorene Lim, Ashlyn S. Kerr, Shihan Li, Chen Zhu, Wang Jin, Thiago M. Steiner, Takahiro Asatsuma, Brooke J. Wanrooy, Zihan Liu, Marcus Z. W. Tong, Megan S. F. Soon, Jessica Engel, Kalyan Shobhana, Adam P. Uldrich, David Khoury, Zewen Kelvin Tuong, Hamish W. King, Ashraful Haque
|
Nature
Verified
SREBP2 promotes macrophage alternative activation and allergic airway inflammation independent of cholesterol biosynthesis
|
Abstract Immunometabolic reprogramming is increasingly recognized as a critical regulator of macrophage activation and function. This study aimed to elucidate the role of the SREBP2-cholesterol biosynthetic pathway in M2 activation of interstitial macrophages (IMs) during allergic asthma. We observed a significant expansion of M2-polarized IMs with heightened SREBP2-cholesterol biosynthetic activity in the lungs of asthmatic mice.
By Yinfang Wu, Kua Zheng, Lingling Dong, Shenwei Gao, Yanping Wu, Zhengyuan Liu, Jieyu Li, Haipin Chen, Qingyu Weng, Miao Li Verified, Chen Zhu, Jiahuan Xu, Songmin Ying, Zhihua Chen
|
Nature
Verified
trans- 2-Hexenal exposure enhances disease resistance against Penicillium digitatum by stimulating phenylpropanoid biosynthesis and antioxidant capacity in postharvest citrus fruit
CONFLICT OF INTEREST The authors declare no conflicts of interest. DATA AVAILABILITY STATEMENT The data that support the findings of this study are available from the corresponding author upon reasonable request. Supporting Information Filename Description jsfa70694-sup-0001-Supinfo.docxWord 2007 document , 1.1 MB Figure S1. Effects of Phe at different concentrations induced treatment on disease symptoms in citrus fruit inoculated with P. digitatum. Figure S2.
Applying asymmetric-waveform alternating current in nickel-catalyzed asymmetric reductive cross-coupling
Abstract Asymmetric waveform alternating current electrocatalysis (asym. AC-eChem) is introduced as a powerful and versatile platform that overcomes key limitations in electrochemical reductive cross-coupling chemistry. By precisely tuning electrode materials, forward / reverse current magnitude, duty ratio, and frequencies, asym. AC-eChem effectively addresses challenges associated with traditional direct current (DC) methods, such as cathodic over-reduction and anodic metal salt deposition.
Programmable divergent electrochemical ring-opening multifunctionalization of strained rings
Abstract The ring-opening functionalization of strained rings represents a highly valuable transformation. However, existing strategies predominantly focus on ring-opening difunctionalization, as initial derivatization typically diminishes the reactivity of surrounding C–H bonds. Consequently, the selective control over site, regio and oxidation state among multiple inert C–H/C–C bonds remains a major unmet challenge.
Discovery of MARK2 as a physiological kinase for PER2 in the mammalian clock
Keywords circadian clock PER2 S662 phosphorylation FASP biochemical purification MARK2 Get full text access Log in, subscribe or purchase for full access. References 1. Roenneberg, T. ∙ Merrow, M. The Circadian Clock and Human Health Curr. Biol. 2016; 26:R432-R443 2. Parsons, M.J. ∙ Moffitt, T.E. ∙ Gregory, A.M. ... Social jetlag, obesity and metabolic disorder: investigation in a cohort study Int. J. Obes. 2015; 39:842-848 3. Ohlander, J. ∙ Keskin, M.C. ∙ Stork, J. ...
Lipid metabolism drives dietary effects on T cell ferroptosis and immunity - Nature
|
Abstract Ferroptosis, a major mechanism of non-apoptotic programmed cell death, critically regulates the homeostasis and functionality of peripheral CD4+ and CD8+ T cells1,2,3,4,5,6. Here we demonstrate that in mouse, resistance of T cells to ferroptosis depends critically on the composition of standard rodent diets, and that dietary effects on ferroptosis (DEFs) have a crucial role in regulation of T cell homeostasis and immune responses.
By Naiqi Wang, Zhian Chen, Yin Yao, Chenglong Sun, Wei Wei, Lei Sun, Hao Zhang, Feng LI, Daniel Butcher, Shi-Ran Sun, Jialei Gong, Yanfei Qi, Jingxuan Huang, Rui Liu, Xiaoyue Zheng, Chenyu Li, Haoyuan Geng, Limin Zhao, Hongjian Sun, Yexin Ge, Mehrdad Pazhouhandeh, Christopher K Barlow, Katherine Jeppe, Joseph Yunis, Chen Zhu, Yunbo Wei, Xiaowen Liang, Kim Bridle, David Frazer, Siok-Keen Tey, Yuhua Li, Zhaohui Yang, Minglei Shu, Zheng Liu, Darrell Crawford, Di Yu, Yingxin Celia Jiang, Sam Nettelfield
|
Nature
Verified
An LCA-assisted hierarchical design of radiative cooling coating for full life-cycle CO2 reduction - Nature Communications
Abstract Reducing CO2 emissions throughout a product’s life cycle, mainly encompassing four stages of raw materials extraction, processing, service, and end of life, is essential for carbon neutrality. Passive daytime radiative cooling coatings offer CO2 reduction benefits, but primarily only during service stage. Life cycle assessment demonstrates maximized full life-cycle CO2 reduction requires innovations in both raw materials extraction and service periods.
Stereoselective Access to Trifunctionalized Z‐Allylic Alcohols via Radical‐Mediated 1,4‐Aryl Migration
1 Introduction The allylic alcohol structural motif is extensively found in a wide range of natural products and pharmaceutical molecules (Scheme 1A) [1]. Owing to its diverse and notable reactivity, allylic alcohol derivatives also serve as versatile synthetic building blocks for the construction of complex molecular architectures, including drugs, agrochemicals, and functional polymers [2-4].
Latent Temporal Discrepancy as Motion Prior: A Loss-Weighting Strategy for Dynamic Fidelity in T2V
arXivLabs is a framework that allows collaborators to develop and share new arXiv features directly on our website. Both individuals and organizations that work with arXivLabs have embraced and accepted our values of openness, community, excellence, and user data privacy. arXiv is committed to these values and only works with partners that adhere to them. Have an idea for a project that will add value for arXiv's community? Learn more about arXivLabs.
Homologative Radical 1,3‐Dicarbofunctionalization of Unactivated Alkenes Enabled by Sequential Functional Group Migrations
Despite significant advances in conventional radical-mediated 1,2-difunctionalization of alkenes over the past decade, homologative 1,3-difunctionalization remains largely underdeveloped. Herein, we report a novel photoinduced homologative 1,3-dicarbofunctionalization of unactivated alkenes via one-carbon chain elongation, achieved through sequential functional group migrations.
Triangulated evidence from the UK and China reveals the health impact of vegetarianism
Observational studies often suggest health advantages of vegetarian diets, but evidence for cancer and cardiovascular disease is inconsistent, confounded and rarely causal; broader physiological and behavioural effects remain uncertain.
Nanoclusters as Deep‐Red Light‐Absorbing Photocatalysts for Laser‐ or LED‐Driven Povarov Cyclization
Photocatalysis is primarily initiated with ultraviolet/blue light, which has several drawbacks, namely, deficiencies in reaction efficiency, and scalability. Designing catalysts that can absorb low-energy light offers a promising solution aiming at these drawbacks.
Temporal niche partitioning by nocturnal arboreal mammals increases the modularity of plant-frugivore networks in a fragmented subtropical landscape
1 INTRODUCTION Seed dispersal by frugivores (fruit-eating animals) is essential for maintaining biodiversity and ecosystem functioning, with over half of all vascular plant species relying on animal vectors for seed transport (Fricke & Svenning, 2020; Howe & Smallwood, 1982). However, our understanding of plant–frugivore interactions has often been shaped by taxonomic and methodological biases, typically focusing on specific frugivore guilds (Donatti et al., 2011; Quintero et al., 2022).
Coexistence of endobronchial aspergilloma, pulmonary embolism, and lung cancer: a case report
Background Endobronchial aspergilloma (EBA) represents an uncommon form of pulmonary aspergillosis characterized by the formation of a fungal mass within the bronchial lumen. It typically develops in patients with pre-existing airway abnormalities, such as those resulting from tumors, foreign bodies, tuberculosis, or chronic obstructive pulmonary disease (COPD) (1, 2).
MV-Flow imaging for evaluating the placental function of gestational diabetes mellitus
Introduction Gestational diabetes mellitus (GDM) is defined as an abnormal glucose tolerance first detected during pregnancy, and it affects approximately 14% of pregnancies annually worldwide (1). GDM is significantly associated with adverse pregnancy outcomes, including macrosomia, pre-eclampsia, fetal growth restriction, and preterm delivery (2). Glycated hemoglobin (HbA1c) reflects the average blood glucose over the most recent 2- to 3-month period (3).
Dearomative syn-1,4-hydroalkylation and C(sp2)−H alkylation of arenes controlled by chemoselective electrolysis - Nature Chemistry
Abstract Dearomative functionalization of arenes represents a powerful synthetic strategy for the rapid assembly of complex chemical architectures. A significant challenge in this process is overcoming the inherent aromaticity of arenes. Here, leveraging the potential of organic electrolysis, we show the development of a dearomative syn-1,4-hydroalkylation reaction targeting electron-deficient arenes and heteroarenes.
Retailer alliance and power structure shift in green brand supply chain under low-carbon operating environment
Abstract Considering a low-carbon operating environment featured by consumer low-carbon preference (CLP) and hybrid carbon policies, we construct a green brand supply chain consisting of a dominant manufacturer and two retailers. Under the green brand (GB) strategy, the manufacturer achieves green production through green technology and recycling, and the two retailers conduct green marketing activities.
Diversity‐Oriented Post‐Polymerization Modifications by Developing gem‐Diboryl Polyolefin as a Platform Polymer
Conflict of Interests The authors declare no conflict of interest. Supporting Information Filename Description anie70046-sup-0001-SuppMat.pdf7.6 MB Supporting Information References 1, Chem. Rev. 2009, 109, 5157–5214, https://doi.org/10.1021/cr9000258. 2, , Chem. Sci. 2016, 7, 1674–1689, https://doi.org/10.1039/C5SC03505H. 3, , , , , , , , , , , , , , , , , , , , , , , , , , , , , , et al., Mater. Chem. Front. 2020, 4, 1803–1915. 4, , , , , , , , , , Angew. Chem. Int.
Our engineering team is making versatile, tiny sensors from Nobel-winning metal-organic frameworks
When the 2025 Nobel Prize in Chemistry honored Omar Yaghi—the "father of metal-organic frameworks," or MOFs—along with Susumu Kitagawa and Richard Robson, it celebrated more than the creation of a new class of crystalline materials. It recognized a revolution quietly reshaping how scientists capture, store and sense molecules. These MOFs could allow for sensor technologies that make workplaces, the environment and human bodies safer. What are MOFs, and why do they matter?
Case Report: Management challenges of active tuberculosis complicated by thrombocytosis and squamous cell lung carcinoma
Abstract Background: This report assesses the feasibility of a sequential treatment strategy for a patient with active tuberculosis (TB) complicated by thrombocytosis and squamous cell lung carcinoma, involving initial anti-TB therapy combined with aspirin, followed by anticancer treatment. It highlights the challenge of balancing infection control, hematologic stability, and oncologic management in this complex scenario.
Our engineering team is making versatile, tiny sensors from the Nobel-winning ‘metal-organic frameworks’ Original
When the 2025 Nobel Prize in Chemistry honored Omar Yaghi – the “father of metal-organic frameworks,” or MOFs – along with Susumu Kitagawa and Richard Robson, it celebrated more than the creation of a new class of crystalline materials. It recognized a revolution quietly reshaping how scientists capture, store and sense molecules. These MOFs could allow for sensor technologies that make workplaces, the environment and human bodies safer. What are MOFs, and why do they matter?
Triangulated evidence from the UK and China reveals the health impact of vegetarianism
Results Identifying health and behavioural outcomes for vegetarianism in PheWAS In the PheWAS analysis, we investigated a total of 443 health and behavioural traits spanning nine groups as reported in table 1 and online supplemental table 1. Figure 2a shows the geographic distributions of the average VegPGS at the local authority level in UKB. Summary information—(a) summary of phenotype groups in PheWAS analyses Geographic distributions of VegPGS and proportions of vegetarians in UKB.
Mechanisms controlling albite dissolution/precipitation kinetics as a function of chemical affinity: New insights from experiments in 29Si spiked solutions at 150 and 180 °C
Article Dans Une Revue Geochimica et Cosmochimica Acta Année : 2024 Mechanisms controlling albite dissolution/precipitation kinetics as a function of chemical affinity: New insights from experiments in 29Si spiked solutions at 150 and 180 °C Fichier principal 1-s2.0-S0016703724001479-am.pdf (4.9 Mo) Télécharger le fichier Origine Fichiers produits par l'(les) auteur(s) insu-04831471 , version 1 (12-09-2025) Jacques Schott, Giuseppe D. Saldi, Chen Zhu, Lei Gong, Kaiyun Chen.
Joint Associations of Frailty and Cardiometabolic Diseases With Risk of All-Cause and Cardiac Mortality:
With population ageing and extended life expectancy, long-lasting chronic diseases and ageing-related physical function impairment have contributed to an increasing disease burden to both individuals and health care systems.1 In decades, a cluster of chronic conditions, cardiometabolic diseases (CMDs) (including coronary heart disease [CHD], stroke, and diabetes here), have been a leading cause of mortality for middle-aged and older adults worldwide,2 and the coexistence of ≥2 CMDs in an...
Maintaining basal B‐RAF kinase activity for abscisic acid signaling via reciprocal phosphoregulation of a single serine residue
INTRODUCTION Drought, cold, and salinity induce the accumulation of phytohormone abscisic acid (ABA), which plays a central role in plant abiotic stress responses (Chen et al., 2020; Komatsu et al., 2020; Hsu et al., 2021; Kavi Kishor et al., 2022; Waadt et al., 2022; Yoshida and Fernie, 2024). Abscisic acid also participates in normal growth, flowering, and plant immunity (Yoshida et al., 2019; Hu et al., 2022; Liu et al., 2022; Miao et al., 2022).
Switchable electrochemical pathways for the selective C(sp3)-Ge bond formation - Nature Communications
Abstract The development of efficient and general strategies for constructing alkyl germanes is crucial due to their significant roles in various areas that impact human quality of life. Herein, we report a robust electrochemically driven method for the construction of alkyl germanes, utilizing a variety of functionalized alkyl nitriles and commercially available chlorogermanes.
Single‐Site Metal‐Nonmetal Microenvironment Regulation of Copper Nanoclusters with Atomic Precision for X‐Ray Imaging
Conflict of Interests The authors declare no conflict of interest. Supporting Information Filename Description anie202511261-sup-0001-SuppMat.docx6.9 MB Supporting Information anie202511261-sup-0002-SuppMat.zip1.9 MB Supporting Information References 1, , Nat. Rev. Mater. 2023, 8, 372–389. 2, , , , Chem. Rev. 2016, 116, 10346–10413. 3, , Chem. Rev. 2017, 117, 8208–8271. 4, , , , , , , , Nat. Rev. Mater. 2025. 10, 89–108. 5, , , , , , , , , , , , J. Am. Chem. Soc. 2024, 146, 5759–5780. 6, , , , , Chem. Rev.
Arsenic trioxide could promote SARS-CoV-2 NSP12 protein degradation
Article metrics loading... /content/journal/jgv/10.1099/jgv.0.002121 Download as PowerPoint /deliver/fulltext/jgv/106/7/jgv002121.html?itemId=/content/journal/jgv/10.1099/jgv.0.002121&mimeType=html&fmt=ahah References Dandekar R, Wang E, Barbastathis G, Rackauckas C. Implications of delayed reopening in controlling the COVID-19 surge in Southern and West-Central USA.
Body Temperature Actuated Liquid Crystal Elastomers from Hyper Tensile Preprogramming
Conflict of Interest The authors declare no conflict of interest.
Abiotic Factors and Plant Communities Shape the Distribution of Soil Pathogenic Oomycetes in Chinese Grasslands
Oomycetes Abundance Quantification with Plasmid and Sequencing This work constructed a plasmid with primers targeting internal transcribed spacer 1 (ITS1) to quantify soil oomycetes abundance. ≈160 bp artificial DNA fragment was synthesized and ligated with forward and reverse oomycete-specific primers (Forward primer OOMUP18Sc: 5′- TGCGGAAGGATCATTACCACAC -3′, and reverse primer ITS2-OOM: 5′- GCAGCGTTCTTCATCGATGT -3′) at both fragment ends.
Modular access to alkylfluorides via radical decarboxylative-desulfonylative gem-difunctionalization - Nature Communications
Abstract Fluorine-containing compounds hold pivotal importance in life sciences. Recent decades have witnessed significant research efforts toward developing practical fluorination methods. Radical-mediated decarboxylative fluorination has proven to be a robust approach for incorporating diverse monofluoroalkyl groups. Here we show a radical-mediated modular synthesis of alkyl fluorides through a decarboxylative-desulfonylative gem-difunctionalization under mild photochemical conditions.
Author Correction: Peptide-based inflammation-responsive implant coating sequentially regulates bone regeneration to enhance interfacial osseointegration | Nature Communications
Correction to: Nature Communications https://doi.org/10.1038/s41467-025-58444-8, published online 6 April 2025 In the version of the article initially published, in Fig. 9a, the text “Day 0” appeared originally as “0” and “Week 8” appeared originally as “Week”; the figure is amended in the HTML and PDF versions of the article.
Assessing Semiregional Cerebral Oxygen Consumption (CMRO2) in Preterm Neonates: A Quantitative MRI Cohort Study With Exploratory Analysis of Respiratory Support
ASL arterial spin labeling CMRO2 cerebral metabolic rate of oxygen CSaO2 cerebral arterial oxygen saturation CSvO2 cerebral venous oxygen saturation GA gestational age CGM cortical grey matter DGM deep grey matter Hct hematocrit NICU neonatal intensive care unit NIRS near-infrared spectroscopy OEF oxygen extraction fraction PMA post-menstrual age PPM parts per million QSM quantitative susceptibility mapping T2-TRIR T2 Prepared Tissue Relaxation Inversion Recovery TRUST...
Arylation of gold nanoclusters and insights into structure-related CO2 reduction reaction performances
Arylation of gold nanoclusters and insights into structure-related CO2 reduction reaction performances† Research on arylgold complexes and ligand-protected gold nanoclusters has proceeded independently thus far due to the difficulty in controllably introducing aryl groups to synthesize arylgold nanoclusters. Herein we synthesized an arylgold Au15 nanocluster, Au15(DPPOE)3(S-PhpMe)4(Ph)2, thereby bridging the two independent research fields.
Access to spirocyclic vinyl sulfones via radical cyclization and functional group migration
Access to spirocyclic vinyl sulfones via radical cyclization and functional group migration† Spirocyclic vinyl sulfones, which incorporate the three-dimensional structure inherent to spiro compounds and the Michael acceptor reactivity associated with vinyl sulfones, hold promise for novel biological activities. The lack of efficient synthetic methods, however, hinders their extensive investigations in drug discovery and development.
Mimicking Excitatory and Inhibitory Behaviors with Optical-Absorption and Electrical-Switch Heterostructures
Mimicking Excitatory and Inhibitory Behaviors with Optical-Absorption and Electrical-Switch Heterostructures Inspired by human brain neural networks, two-terminal optoelectronic synaptic devices could process large amounts of information and promise to pave the way for overcoming the von Neumann bottleneck in non-traditional computing.
Show More
loading
Actions
Is this you?
As a journalist, you can create a free Muck Rack account to customize your profile, list your contact preferences, and upload a portfolio of your best work.Get in touch with Chen
Contact Chen, search articles and posts on X, monitor coverage, and track replies from one place.
Learn more about Muck Rack